# LinearDesign **Repository Path**: Dledger/LinearDesign ## Basic Information - **Project Name**: LinearDesign - **Description**: No description available - **Primary Language**: Unknown - **License**: Not specified - **Default Branch**: main - **Homepage**: None - **GVP Project**: No ## Statistics - **Stars**: 0 - **Forks**: 0 - **Created**: 2026-08-20 - **Last Updated**: 2026-08-20 ## Categories & Tags **Categories**: Uncategorized **Tags**: None ## README Baidu Research Logo # Algorithm for Optimized mRNA Design Improves Stability and Immunogenicity (LinearDesign) ![GitHub all releases](https://img.shields.io/github/downloads/LinearDesignSoftware/LinearDesign/total) This repository contains the source code for the LinearDesign project. He Zhang†, Liang Zhang†, Ang Lin†, Congcong Xu†, Ziyu Li, Kaibo Liu, Boxiang Liu, Xiaopin Ma, Fanfan Zhao, Huiling Jiang, Chunxiu Chen, Haifa Shen, Hangwen Li*, David H. Mathews*, Yujian Zhang*, Liang Huang†*#. Algorithm for Optimized mRNA Design Improves Stability and Immunogenicity. Nature [https://doi.org/10.1038/s41586-023-06127-z](https://doi.org/10.1038/s41586-023-06127-z) (2023) † contributed equally, \* corresponding authors, # lead corresponding author For questions, please contact the lead corresponding author at . ## Dependencies Clang 11.0.0 (or above) or GCC 4.8.5 (or above) python2.7 ## To Compile ``` make ``` ## To Run The LinearDesign program can be run with: ``` echo SEQUENCE | ./lineardesign [OPTIONS] OR cat FASTA_FILE | ./lineardesign [OPTIONS] ``` OPTIONS: ``` --lambda LAMBDA or -l LAMBDA ``` Set LAMBDA, a hyperparameter balancing MFE and CAI. (default 0.0) ``` --codonusage FILE_NAME or -c FILE_NAME ``` Import a Codon Usage Frequency Table. See "codon_usage_freq_table_human.csv" for the format. (default: using human codon usage frequency table) ``` --verbose or -v ``` Print out more details. (default False) For Macbook, users may encounter a pop-up message at the first run. For Mac-M1 system, the message is: ``` "LinearDesign_Mac_M1.so" can't be opened because Apple cannot check it for malicious software. ``` For Mac-Intel system, the message is: ``` "LinearDesign_Mac_Intel.so" cannot be opened because it is from an unidentified developer. ``` If so, please go to "System Preferences -> Security & Privacy -> General" to allow LinearDesign-Mac-M1.so (or LinearDesign-Mac-Intel.so) to open. ## Example: Single Sequence Design ``` echo MNDTEAI | ./lineardesign mRNA sequence: AUGAACGAUACGGAGGCGAUC mRNA structure: ......(((.((....))))) mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.695 ``` ## Example: Multiple Sequences Design with Option --lambda (-l) ``` cat testseq | ./lineardesign --lambda 3 >seq1 mRNA sequence: AUGCCAAACACCCUGGCAUGCCCC mRNA structure: ((((((.......))))))..... mRNA folding free energy: -6.00 kcal/mol; mRNA CAI: 0.910 >seq2 mRNA sequence: AUGCUGGAUCAGGUGAACAAGCUGAAGUACCCAGAGGUGAGCCUGACCUGA mRNA structure: .....((.((((((..((...(((.......)))..))..))))))))... mRNA folding free energy: -13.50 kcal/mol; mRNA CAI: 0.979 ``` ## Example: Option --codonusage (-c) ``` echo MNDTEAI | ./lineardesign -l 0.3 --codonusage codon_usage_freq_table_yeast.csv mRNA sequence: AUGAAUGAUACGGAAGCGAUC mRNA structure: ......(((.((....))))) mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.670 ``` ## Example: Option --verbose (-v) ``` echo MNDTEAI | ./lineardesign --verbose Input protein: MNDTEAI Using lambda = 0; Using codon frequency table = codon_usage_freq_table_human.csv mRNA sequence: AUGAACGAUACGGAGGCGAUC mRNA structure: ......(((.((....))))) mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.695 Runtime: 0.002 seconds ``` ## Declarations Baidu Research has filed a patent for the LinearDesign algorithm that lists He Zhang, Liang Zhang, Ziyu Li, Kaibo Liu, Boxiang Liu, and Liang Huang as inventors.